Review





Similar Products

gene exp ucp1 mm01244861 m1  (Thermo Fisher)
99
Thermo Fisher gene exp ucp1 mm01244861 m1
Gene Exp Ucp1 Mm01244861 M1, supplied by Thermo Fisher, used in various techniques. Bioz Stars score: 99/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/result/gene exp ucp1 mm01244861 m1/product/Thermo Fisher
Average 99 stars, based on 1 article reviews
gene exp ucp1 mm01244861 m1 - by Bioz Stars, 2026-02
99/100 stars
  Buy from Supplier
gene exp ucp1 rn00562126 m1  (Thermo Fisher)
97
Thermo Fisher gene exp ucp1 rn00562126 m1
A , Strategy for targeted deletion of the <t>Ucp1</t> gene. Top: The target sequence (blue) was TGATTTCCAGATCCAAGGTGAAGGC, adjacent to a TTTC PAM site (red) in exon 2. Bottom: Site of the deletion (red bar) as determined by sequencing. B , Microchip-based capillary electrophoresis showing a 17-bp deletion in the rat Ucp1 gene; the two upshifted bands in heterozygous (Hz) rats represent heteroduplexes. C , Western blot confirming the absence of <t>UCP1</t> <t>protein</t> in UCP1 knockout (KO) rats. D , Interscapular brown adipose tissue (BAT) present in wild-type (WT) rats is replaced by white adipose tissue (WAT) in UCP1 KO rats. E , Hematoxylin–eosin staining of interscapular adipose tissue revealing enlarged lipid vacuoles in UCP1 KO rats. Scale bar, 50 µm. F , A β 3 -adrenergic agonist induces sustained hyperthermia in WT but not UCP1 KO rats; the initial temperature peak reflects handling stress associated with injection at time 0. Solid lines show the mean, and dotted lines show the SEM. n = 4. G , UCP1 KO rats display impaired cold defense during exposure to 4 °C.
Gene Exp Ucp1 Rn00562126 M1, supplied by Thermo Fisher, used in various techniques. Bioz Stars score: 97/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/result/gene exp ucp1 rn00562126 m1/product/Thermo Fisher
Average 97 stars, based on 1 article reviews
gene exp ucp1 rn00562126 m1 - by Bioz Stars, 2026-02
97/100 stars
  Buy from Supplier
nonspecif ic staining blockage  (Proteintech)
96
Proteintech nonspecif ic staining blockage
A , Strategy for targeted deletion of the <t>Ucp1</t> gene. Top: The target sequence (blue) was TGATTTCCAGATCCAAGGTGAAGGC, adjacent to a TTTC PAM site (red) in exon 2. Bottom: Site of the deletion (red bar) as determined by sequencing. B , Microchip-based capillary electrophoresis showing a 17-bp deletion in the rat Ucp1 gene; the two upshifted bands in heterozygous (Hz) rats represent heteroduplexes. C , Western blot confirming the absence of <t>UCP1</t> <t>protein</t> in UCP1 knockout (KO) rats. D , Interscapular brown adipose tissue (BAT) present in wild-type (WT) rats is replaced by white adipose tissue (WAT) in UCP1 KO rats. E , Hematoxylin–eosin staining of interscapular adipose tissue revealing enlarged lipid vacuoles in UCP1 KO rats. Scale bar, 50 µm. F , A β 3 -adrenergic agonist induces sustained hyperthermia in WT but not UCP1 KO rats; the initial temperature peak reflects handling stress associated with injection at time 0. Solid lines show the mean, and dotted lines show the SEM. n = 4. G , UCP1 KO rats display impaired cold defense during exposure to 4 °C.
Nonspecif Ic Staining Blockage, supplied by Proteintech, used in various techniques. Bioz Stars score: 96/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/result/nonspecif ic staining blockage/product/Proteintech
Average 96 stars, based on 1 article reviews
nonspecif ic staining blockage - by Bioz Stars, 2026-02
96/100 stars
  Buy from Supplier
gene exp ucp1 hs00222453 m1  (Thermo Fisher)
94
Thermo Fisher gene exp ucp1 hs00222453 m1
Effects of propionate on mitochondrial respiration in distinct adipose tissue depots. Seahorse bioanalysis and gene expression were performed on cultured AT treated for 24 hours with propionate (1 mM) or a vehicle control. A, A seahorse mito stress test was performed on AT to assess key parameters of mitochondrial respiration. Dotted lines indicate injections into media of the specific compounds: oligomycin A, BAM15, and rotenone/antimycin A (R&A). B, Basal respiration. C, Maximum respiration. D, Proton leak. E, Spare respiratory capacity (mean ± SEM, n = 6). F and G, Relative messenger RNA expression of <t>UCP1</t> and PGC1α in AT in response to propionate (1 mM) treatment vs vehicle control (mean ± SEM, n = 5). # P less than .05, propionate vs vehicle control; * P less than .05; **** P less than .0001. Abbreviations: AT, adipose tissue; M, mesenteric; O, omental; S, subcutaneous.
Gene Exp Ucp1 Hs00222453 M1, supplied by Thermo Fisher, used in various techniques. Bioz Stars score: 94/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/result/gene exp ucp1 hs00222453 m1/product/Thermo Fisher
Average 94 stars, based on 1 article reviews
gene exp ucp1 hs00222453 m1 - by Bioz Stars, 2026-02
94/100 stars
  Buy from Supplier
gene exp ucp1 hs01084772 m1  (Thermo Fisher)
85
Thermo Fisher gene exp ucp1 hs01084772 m1
Effects of propionate on mitochondrial respiration in distinct adipose tissue depots. Seahorse bioanalysis and gene expression were performed on cultured AT treated for 24 hours with propionate (1 mM) or a vehicle control. A, A seahorse mito stress test was performed on AT to assess key parameters of mitochondrial respiration. Dotted lines indicate injections into media of the specific compounds: oligomycin A, BAM15, and rotenone/antimycin A (R&A). B, Basal respiration. C, Maximum respiration. D, Proton leak. E, Spare respiratory capacity (mean ± SEM, n = 6). F and G, Relative messenger RNA expression of <t>UCP1</t> and PGC1α in AT in response to propionate (1 mM) treatment vs vehicle control (mean ± SEM, n = 5). # P less than .05, propionate vs vehicle control; * P less than .05; **** P less than .0001. Abbreviations: AT, adipose tissue; M, mesenteric; O, omental; S, subcutaneous.
Gene Exp Ucp1 Hs01084772 M1, supplied by Thermo Fisher, used in various techniques. Bioz Stars score: 85/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/result/gene exp ucp1 hs01084772 m1/product/Thermo Fisher
Average 85 stars, based on 1 article reviews
gene exp ucp1 hs01084772 m1 - by Bioz Stars, 2026-02
85/100 stars
  Buy from Supplier

Image Search Results


A , Strategy for targeted deletion of the Ucp1 gene. Top: The target sequence (blue) was TGATTTCCAGATCCAAGGTGAAGGC, adjacent to a TTTC PAM site (red) in exon 2. Bottom: Site of the deletion (red bar) as determined by sequencing. B , Microchip-based capillary electrophoresis showing a 17-bp deletion in the rat Ucp1 gene; the two upshifted bands in heterozygous (Hz) rats represent heteroduplexes. C , Western blot confirming the absence of UCP1 protein in UCP1 knockout (KO) rats. D , Interscapular brown adipose tissue (BAT) present in wild-type (WT) rats is replaced by white adipose tissue (WAT) in UCP1 KO rats. E , Hematoxylin–eosin staining of interscapular adipose tissue revealing enlarged lipid vacuoles in UCP1 KO rats. Scale bar, 50 µm. F , A β 3 -adrenergic agonist induces sustained hyperthermia in WT but not UCP1 KO rats; the initial temperature peak reflects handling stress associated with injection at time 0. Solid lines show the mean, and dotted lines show the SEM. n = 4. G , UCP1 KO rats display impaired cold defense during exposure to 4 °C.

Journal: bioRxiv

Article Title: Immune and psychogenic fever arise through UCP1-independent thermogenic mechanisms

doi: 10.64898/2026.01.30.702725

Figure Lengend Snippet: A , Strategy for targeted deletion of the Ucp1 gene. Top: The target sequence (blue) was TGATTTCCAGATCCAAGGTGAAGGC, adjacent to a TTTC PAM site (red) in exon 2. Bottom: Site of the deletion (red bar) as determined by sequencing. B , Microchip-based capillary electrophoresis showing a 17-bp deletion in the rat Ucp1 gene; the two upshifted bands in heterozygous (Hz) rats represent heteroduplexes. C , Western blot confirming the absence of UCP1 protein in UCP1 knockout (KO) rats. D , Interscapular brown adipose tissue (BAT) present in wild-type (WT) rats is replaced by white adipose tissue (WAT) in UCP1 KO rats. E , Hematoxylin–eosin staining of interscapular adipose tissue revealing enlarged lipid vacuoles in UCP1 KO rats. Scale bar, 50 µm. F , A β 3 -adrenergic agonist induces sustained hyperthermia in WT but not UCP1 KO rats; the initial temperature peak reflects handling stress associated with injection at time 0. Solid lines show the mean, and dotted lines show the SEM. n = 4. G , UCP1 KO rats display impaired cold defense during exposure to 4 °C.

Article Snippet: The following TaqMan Gene Expression Assays (Thermo Fisher Scientific, Stockholm, Sweden) were used: Ucp1 (Rn00562126_m1), Ucp2 (Rn01754856_m1), Ucp3 (Rn00565874_m1), Ppargc1a (PGC-1α; Rn00580241_m1), and Gapdh (Rn01775763_g1).

Techniques: Sequencing, MicroChIP Assay, Electrophoresis, Western Blot, Knock-Out, Staining, Injection

A . β 3 -adrenergic stimulation and immune challenge. A1, Ucp1 mRNA expression. A2, Ppargc1a mRNA expression. A3 , BAT weight. n = 6-7. B . Darkening of BAT following intraperitoneal β 3 -adrenergic agonist administration, but not after LPS. C . Restraint stress. C1, Ucp1 mRNA expression. C2, Ppargc1a mRNA expression. Error bars indicate SEM. * P < 0.05; ** P < 0.01;*** P < 0.001.

Journal: bioRxiv

Article Title: Immune and psychogenic fever arise through UCP1-independent thermogenic mechanisms

doi: 10.64898/2026.01.30.702725

Figure Lengend Snippet: A . β 3 -adrenergic stimulation and immune challenge. A1, Ucp1 mRNA expression. A2, Ppargc1a mRNA expression. A3 , BAT weight. n = 6-7. B . Darkening of BAT following intraperitoneal β 3 -adrenergic agonist administration, but not after LPS. C . Restraint stress. C1, Ucp1 mRNA expression. C2, Ppargc1a mRNA expression. Error bars indicate SEM. * P < 0.05; ** P < 0.01;*** P < 0.001.

Article Snippet: The following TaqMan Gene Expression Assays (Thermo Fisher Scientific, Stockholm, Sweden) were used: Ucp1 (Rn00562126_m1), Ucp2 (Rn01754856_m1), Ucp3 (Rn00565874_m1), Ppargc1a (PGC-1α; Rn00580241_m1), and Gapdh (Rn01775763_g1).

Techniques: Expressing

Effects of propionate on mitochondrial respiration in distinct adipose tissue depots. Seahorse bioanalysis and gene expression were performed on cultured AT treated for 24 hours with propionate (1 mM) or a vehicle control. A, A seahorse mito stress test was performed on AT to assess key parameters of mitochondrial respiration. Dotted lines indicate injections into media of the specific compounds: oligomycin A, BAM15, and rotenone/antimycin A (R&A). B, Basal respiration. C, Maximum respiration. D, Proton leak. E, Spare respiratory capacity (mean ± SEM, n = 6). F and G, Relative messenger RNA expression of UCP1 and PGC1α in AT in response to propionate (1 mM) treatment vs vehicle control (mean ± SEM, n = 5). # P less than .05, propionate vs vehicle control; * P less than .05; **** P less than .0001. Abbreviations: AT, adipose tissue; M, mesenteric; O, omental; S, subcutaneous.

Journal: The Journal of Clinical Endocrinology and Metabolism

Article Title: Propionate Induces Energy Expenditure via Browning in Mesenteric Adipose Tissue

doi: 10.1210/clinem/dgaf280

Figure Lengend Snippet: Effects of propionate on mitochondrial respiration in distinct adipose tissue depots. Seahorse bioanalysis and gene expression were performed on cultured AT treated for 24 hours with propionate (1 mM) or a vehicle control. A, A seahorse mito stress test was performed on AT to assess key parameters of mitochondrial respiration. Dotted lines indicate injections into media of the specific compounds: oligomycin A, BAM15, and rotenone/antimycin A (R&A). B, Basal respiration. C, Maximum respiration. D, Proton leak. E, Spare respiratory capacity (mean ± SEM, n = 6). F and G, Relative messenger RNA expression of UCP1 and PGC1α in AT in response to propionate (1 mM) treatment vs vehicle control (mean ± SEM, n = 5). # P less than .05, propionate vs vehicle control; * P less than .05; **** P less than .0001. Abbreviations: AT, adipose tissue; M, mesenteric; O, omental; S, subcutaneous.

Article Snippet: The relative expression levels of mRNA of FFAR2 (Hs00271142 s1), CEBPα (Hs00269972 s1), UCP1 (Hs00222453 m1), PPARγ (Hs01115513 m1), PGC1α (Hs00173304 m1), GLUT4 (Hs00168966 m1), tumor necrosis factor α (TNFα) (Hs00174128 m1), interleukin-6 (IL6) (Hs00174131 m1), FASN (Hs01005622 m1), PKM (Hs00761782 s1), and HK2 (Hs00606086 m1) were compared to the vehicle control and normalized to 18S (Hs03003631 g1), using the 2 −ΔΔCt formula.

Techniques: Gene Expression, Cell Culture, Control, RNA Expression

Effects of propionate on adipocyte browning, glucose uptake, and glycolysis. A to C, Relative messenger RNA (mRNA) expression of UCP1, PGC1α, and GLUT4 in adipocytes in response to propionate (1 mM) treatment vs vehicle control (mean ± SEM, n = 6-9). D, Glucose uptake in adipocytes. Ins + Pro: 1 μM insulin and 1 mM Propionate (mean ± SEM, n = 11-12). Unt: untreated; Ins: 1 μM insulin; Ins + Con:1 μM insulin and vehicle control. E and F, Relative mRNA expression of HK2 and PKM in adipocytes in response to propionate (1 mM) treatment vs vehicle control (mean ± SEM, n = 6-9). # P less than .05, ## P less than .01, #### P less than .0001 propionate vs vehicle control; P less than .05 vs Unt group; * P less than .05, ** P less than .01, **** P less than .0001. Abbreviations: A, adipocyte; M, mesenteric; O, omental; S, subcutaneous;.

Journal: The Journal of Clinical Endocrinology and Metabolism

Article Title: Propionate Induces Energy Expenditure via Browning in Mesenteric Adipose Tissue

doi: 10.1210/clinem/dgaf280

Figure Lengend Snippet: Effects of propionate on adipocyte browning, glucose uptake, and glycolysis. A to C, Relative messenger RNA (mRNA) expression of UCP1, PGC1α, and GLUT4 in adipocytes in response to propionate (1 mM) treatment vs vehicle control (mean ± SEM, n = 6-9). D, Glucose uptake in adipocytes. Ins + Pro: 1 μM insulin and 1 mM Propionate (mean ± SEM, n = 11-12). Unt: untreated; Ins: 1 μM insulin; Ins + Con:1 μM insulin and vehicle control. E and F, Relative mRNA expression of HK2 and PKM in adipocytes in response to propionate (1 mM) treatment vs vehicle control (mean ± SEM, n = 6-9). # P less than .05, ## P less than .01, #### P less than .0001 propionate vs vehicle control; P less than .05 vs Unt group; * P less than .05, ** P less than .01, **** P less than .0001. Abbreviations: A, adipocyte; M, mesenteric; O, omental; S, subcutaneous;.

Article Snippet: The relative expression levels of mRNA of FFAR2 (Hs00271142 s1), CEBPα (Hs00269972 s1), UCP1 (Hs00222453 m1), PPARγ (Hs01115513 m1), PGC1α (Hs00173304 m1), GLUT4 (Hs00168966 m1), tumor necrosis factor α (TNFα) (Hs00174128 m1), interleukin-6 (IL6) (Hs00174131 m1), FASN (Hs01005622 m1), PKM (Hs00761782 s1), and HK2 (Hs00606086 m1) were compared to the vehicle control and normalized to 18S (Hs03003631 g1), using the 2 −ΔΔCt formula.

Techniques: Expressing, Control